The cDNA was amplified with forward, tcttgcaaggacagttgcac, and reverse, tcaggcacttgtctcacagc, primers bracketing nucleotides 248–629 in the open reading frame of chicken prestin (GenBank accession number EF028087.1; Schaechinger and Oliver 2007) using Invitrogen Platinum Taq DNA Polymerase (Life Technologies). As a positive control, 200 ng/μl of pEGFP-N1 plasmid containing chicken prestin (Schaechinger and Oliver, 2007; Tan et al., 2011) Apoptosis Compound Library research buy was also amplified with the same primer set. PCR products were electrophoresed on 1% agarose gel. A polyclonal antibody against the N-terminal peptide sequence of rat prestin, CKYLVERPIFSHPVLQE (Bethyl

Laboratories), which is closely homologous to the equivalent sequence in chicken prestin, was used to label the basilar papilla. The antibody was affinity purified and shown to immunolabel rat OHCs (Mahendrasingam et al., 2010). Immunoblots were performed on tissue from fifteen E19 chicken papillae and twelve P11 mice cochleas; mice were decapitated and cochleas dissected out using procedures approved by the Institutional Animal Care and Use Committee of the University of Wisconsin-Madison. Proteins were extracted with Tissue Extraction Reagent I (Invitrogen Life Technologies) plus protease inhibitor Y-27632 concentration cocktail (Sigma-Aldrich), denatured and electrophoretically separated

on a 7.5% SDS-PAGE and blotted onto a 0.45 μm nitrocellulose membrane. Blotted membranes were incubated with the prestin antibody (1:100 dilution) at 4°C overnight then incubated in secondary goat anti-rabbit horseradish L-NAME HCl peroxidase-conjugated antibody (1:1000, Invitrogen) for 90 min at room temperature and stained with Novex chemiluminescent reagent. Chicken papillae were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) for 30 min, washed then permeabilized with 0.5% Triton-X for 30 min. Fixed papillae were immersed in 10% goat serum (Invitrogen) for 1 hr at room temperature and incubated overnight at 4°C with

the prestin antibody (dilution 1:50) and the mouse monoclonal HCS-1 antibody (dilution 1:400) which labels otoferlin in chicken hair cells (Goodyear et al., 2010). After rinsing in PBS, specimens were incubated with Alexa Fluor 488 goat anti-rabbit IgG antibody (1:200; Invitrogen) and goat anti-mouse Alexa Fluor 568 for 90 min and Alexa Fluor 647 phalloidin (1:200; Invitrogen Life Sciences) for 60 min at room temperature. Preparations were mounted in Fluoromount-G medium (SouthernBiotech) with coverslips and viewed under a 60× oil-immersion objective (NA = 1.4) on a Nikon A1 laser scanning confocal microscope. Work was supported by grant RO1 DC01362 from the National Institutes on Deafness and other Communication Disorders to R.F. We thank Dan Yee for constructing electrical equipment, Ana Garic for assistance with molecular biology, Lance Rodenkirch for advice on confocal imaging, Dominik Oliver for the pEGFP-N1 plasmid containing chicken prestin, and Jeff Corwin for the HCS-1 antibody.