This

was followed by 40 cycles of 10 seconds of denaturation at 95°C and 30 seconds of annealing and elongation at the optimal annealing temperature for each specific primer pair (Table 4), during which fluorescence was measured. Next a melt curve analysis was included by increasing the temperature from 55 to 95°C in steps of 0.5°C for 10 seconds, when fluorescence was measured to allow the verification of the presence of one gene-specific peak. The cycle threshold (Ct value) was determined by the iQ5 Optical System Software from Bio-Rad Laboratories. All samples were run in duplicate and the average relative expression of each gene was normalized with the this website internal control gene, glyceraldehyde 3-P dehydrogenase (gapA) and the relative fold change was calculated using 2-∆∆Ct method [27]. Table 4 List of primers used for qRT-PCR Namea Strainb Sequence 5RTagaA EDL933 CCGTTTCTCAGCACACCTTA 3RTagaA EDL933 CCCAGCATCACTCGTACATT 5RTnagA EDL933 TTACCTTTGCCACCCATCTG 3RTnagA EDL933 GCAGGCCATCAGCGATAATA

find more 5RTnagB EDL933 ATCTGTTTATGGGCGGTGTAG 3RTnagB EDL933 GAGTGTCATGAGTCAGGGTTT 5RTagaA E. coli C ACTTCACGCCGCAGAATAA 3RTagaA E. coli C GCTGAGAAACGGCAATCAAC 5RTagaR E. coli C ACGGTATGAACGTGGCTAATG 3RTagaR E. coli C CAGCCTGATCGCCGTAAA 5RTagaS Both ATCCGCTGCTGTTGATCTC 3RTagaS Both GGTGATAGCATTCCGGTACAA 5RTnagA E. coli C CCGTGGCTGAATCTGGTAAA 3RTnagA E. coli C ATGACGTCGGCGTTCTTAC 5RTnagB E. coli C ATCTGTTTATGGGCGGTGTAG 3RTnagB E. coli C GAGTGTCATGAGTCAGGGTTT 5RTgapA Both CGACCTGTTAGACGCTGATTAC 3RTgapA Both CGATCAGATGACCGTCTTTCAC a The primer names indicate the genes that are targeted for quantification of transcript. The number, 5 preceding the name of the gene indicate forward primers and the number, 3 preceding the name of the gene indicates reverse primers. b The strain name indicates the sequence used to design the primer was from that strain and when the same primer is used for both strains it is indicated as both. Acknowledgements We thank Chris Elkins, Gene

LeClerc, and Galeb Abu-Ali for critically reading the manuscript and helpful discussions. We thank Carmen Tartera for providing the phenotypic microarray data. The views presented in this article do not necessarily reflect those of the Food and Drug Administration. References 1. Reizer J, Ramseier Docetaxel TM, Reizer A, Charbit A, Saier MJ Jr: Novel phosphotransferase genes revealed by bacterial genome sequencing: a gene cluster encoding a putative N-acetylgalactosamine metabolic pathway in Escherichia coli . Microbiology 1996,142(2):231–250.PubMedCrossRef 2. White RJ: Control of amino sugar metabolism in Escherichia coli and isolation of mutants unable to degrade amino sugars. Biochem J 1968,106(4):847–858.PubMed 3. Plumbridge JA: Sequence of the nagBCD operon in Escherichia coli K12 regulon and pattern of transcription within the nag regulon. Mol Microbiol 1989,3(4):505–515.PubMedCrossRef 4.