An intrauterine injection of lipopolysaccharide (LPS) was administered to CD1 mice at embryonic day 16, ± CRTH2 agonist/vehicle controls. Mice were killed at 4.5 hr to assess fetal wellbeing and to harvest myometrium and pup brain for analysis of NF-κB, and T helper type 1/2 interleukins. To examine the effects of the CRTH2 agonist on LPS-induced preterm labour, mice were allowed to labour spontaneously. Direct effects of the CRTH2 agonist on uterine Selleck GSI-IX contractility were examined ex vivo on contracting myometrial strips. The CRTH2 agonist increased fetal survival from 20 to 100% in LPS-treated mice,

and inhibited circular muscle contractility ex vivo. However, it augmented LPS-induced labour and significantly increased myometrial NF-κB, IL-1β, KC-GRO, interferon-γ and tumour necrosis factor-α. This suggests that the action of 15dPGJ2 is not via CRTH2 and therefore small molecule CRTH2 agonists are not likely to be beneficial for the prevention of inflammation-induced preterm labour. Preterm labour is one of the most challenging complications of human pregnancy. Its incidence in the western world remains between 6 and 15% depending on the geography and demographics of the population.[1] It

is a heterogeneous condition,[2] with the only firm causal link being that of infection.[3] Despite the increased awareness of the association between infection and inflammation and preterm labour,[4] there have been limited advances in the treatment and prevention of preterm labour. Currently, there is a drive to develop anti-inflammatory therapies to not only delay preterm labour, BAY 80-6946 but to prevent the long-term neurological damage thought to be a

result of the impact of pro-inflammatory factors on fetal inflammatory response syndrome. The transcription factor nuclear factor-κB (NF-κB), which is classically associated with inflammation, is central to regulating the biochemical pathways involved in both term labour and preterm labour.[5] The oxytocin receptor and cyclo-oxygenase-2 (COX-2) genes contain NF-κB response elements in their promoter regions.[6, 7] The oxytocin receptor mediates oxytocin-induced myometrial contractions through activation of phospholipase C and downstream calcium release from intracellular PRKACG stores.[8] The COX-2 enzyme is the rate-limiting step for prostaglandin synthesis, which is responsible for uterine contractions and cervical dilatation. NF-κB is also involved in the transcriptional regulation of matrix metalloproteinases, including matrix metalloproteinase-9, which are required for remodelling of the extracellular matrix,[9] leading to cervical ripening and fetal membrane rupture. A positive feed-forward loop also exists from activation of NF-κB by the pro-inflammatory cytokines and subsequently their transcriptional activation, including tumour necrosis factor-α (TNF-α) and interleukin-1β (IL-1β).

1) at ETS/IRF composite elements (EICE), description of AP-1/IRF composite elements (AICE) reveals how these factors function together to bind distinct elements

co-operatively, and may explain some of their distinct functions in T-cell subsets, dendritic cells and B cells. At AICE, combinatorial integration is possible through both varied AP-1 dimer composition and choice of IRF family co-factors. For example, IRF8 co-operates with BATF3/JUN to instruct homeostatic classical dendritic cell (cDC) differentiation, and with BATF/JUN during inflammatory cDC differentiation.[40] BATF/JUN and IRF4 co-operative binding at AICE motifs is required for instruction of Th17 Cell Cycle inhibitor differentiation and B-cell class switch recombination.[12,

30, 31, 40] Further, it is likely that co-operation of these AP-1/IRF complexes with different STAT family members can confer additional integration of environmental cues for interpretation of combinatorial motifs in regulatory DNA elements. Transcriptional programmes that integrate environmental signals with cell intrinsic features instruct cellular phenotypes, including plasticity. In this context, it is interesting to compare and contrast the transcriptional strategies of FOXP3 and RORγt in control of Treg and Th17 cell identity, respectively. Recent mechanistic insights into the transcriptional regulation of Foxp3 and Rorc and their targets explain some of the characteristics of the Treg and Th17 cellular phenotype. For example, both FOXP3 and RORγt have in common an activity that largely reinforces, stabilizes and maintains a chromatin Selleck Talazoparib and gene activation landscape initiated

by ERFs. More specifically, these factors augment the expression of critical lineage-specific genes such as il2ra, ctla4, il10, il10ra, cd5, icos and notably, Foxp3 itself, in the case of FOXP3, and il17a, il17f, il1r1 and il23r for RORγt (Fig. 1). This target gene selection reflects the distinct behaviour and biology of Th17 and Treg cells. RORγt augments il23r expression in a positive feedback loop, as STAT3 signalling downstream of IL-23R activates Rorc expression. However, this feedback loop, and maintained expression triclocarban of Rorc and Th17 lineage fidelity, is dependent on the persistence of environmental IL-23 and transforming growth factor-β (TGF-β), and altered environmental signals, especially IL-12 and interferon-γ, can subvert Rorc expression and the Th17 transcriptional programme, converting cells to the Th1 lineage (Fig. 2).[42-44] In contrast, FOXP3 regulates its own expression upon engagement of a positive feedback loop following activation and CpG demethylation at a Foxp3-intronic enhancer (CNS2), a heritable feature of mature Treg cells, effectively buffering mature Treg cells from changes in environmental signals.[45] These differences may reflect important phenotypic features of these distinct cell types.

Increased levels of triglycerides are consistently seen in people with type 2 diabetes and microalbuminuria or overt proteinuria.26–28 The high triglyceride levels are associated with an increased proportion of atherogenic small dense LDL cholesterol particles.29 The implication is that serum triglycerides should be as low as possible to prevent atherogenic changes in LDL-cholesterol particles.30 HDL cholesterol levels in people with type 2 diabetes see more have been reported to be normal in association with overt diabetic kidney disease28 whereas decreased HDL-cholesterol levels have been reported in association with microalbuminuria.27 Higher apolipoprotein

(a) levels have been reported in people with type Selleckchem NVP-BGJ398 2 diabetes and micro- and macroalbuminuria than in control subjects, and also in people with macroalbuminuria than with normoalbuminuria.31 Apolipoprotein (a) levels have been related to the rates of progression of albuminuria,32 however, others have not confirmed these findings in people with diabetes and CKD.28 There is evidence to support the hypothesis that changes in lipid profiles may play a causal role in the initiation and progression of kidney disease, based on the finding of lipid deposits and foam cells in the glomeruli of humans with kidney disease.33 Primary or secondary intervention

with statins in hypercholesterolaemic people has shown similar cardioprotective effects in diabetic and non-diabetic subjects.34–36 The absolute clinical benefit achieved by cholesterol lowering may be greater in people with CHD and diabetes than with CHD and without diabetes because people with diabetes have a higher absolute

risk of recurrent CHD events and other atherosclerotic events.34 Observational studies have shown that dyslipidaemia interacts with other risk factors to increase cardiovascular risk.37,38 Dimethyl sulfoxide Microalbuminuria is a risk factor for CVD as well as overt kidney disease in people with type 2 diabetes,39,40 and dyslipidaemia is more common in microalbuminuric than normoalbuminuric people with type 2 diabetes.27 In people with type 1 or type 2 diabetes and increased AER, elevated LDL-cholesterol and triglycerides are common, whereas HDL-cholesterol may be high, low or normal. Nearly all studies have shown a correlation between serum cholesterol concentration and progression of CKD.41,42 Since increased AER and dyslipidaemia are each associated with an increased risk of CHD, it is logical to treat dyslipidaemia aggressively in people with increased AER. Subgroups with diabetes in large intervention studies have confirmed that correction of dyslipidaemia results in a decrease in CHD.43 However, few trials have examined the effects of treating dyslipidaemia on kidney end-points in people with type 2 diabetes and increased AER.

The allergen that is supposed to induce the original allergic responses is named the primary sensitizer, and the others are considered cross-reactive allergens. There are several clinical and laboratory criteria to classify an allergic reaction as cross-reacting, but the condition should be first empirically demonstrated (104). The clinical relevance of IgE cross-reactivity has been described for foods, pollens, mites and other allergen sources (105), but its occurrence between mite and Ascaris allergens, although widely suspected (106), has not been thoroughly investigated. Cross-reactivity

depends on amino acid sequences Opaganib purchase and conformational structures of the molecules, which explains why it is more frequent (but not exclusive)

among phylogenetically related species. Ascaris and mites are related invertebrates and are expected to share several allergens. Independently of which source is the primary sensitizer, among inhabitants of the tropics, allergenic stimulus Sirtuin activator derived from a persistent inhalation of high concentrations of mite allergens and infections with A. lumbricoides may generate a particular immune response that involves cross-reactivity in both directions. Several antigens of Ascaris have been analysed (50,107,108) and other are under scrutiny, but our knowledge about the allergenic composition of the whole extract is still very limited; in fact, the International Union of Immunology Societies only reports the ABA-1 allergen (Asc s 1) and medroxyprogesterone the recently submitted tropomyosin (Asc l 3). Because almost all allergens from domestic mites have been identified, it is now possible to study their cross-reactivity with Ascaris.

We performed dose–response ELISA and immunoblotting inhibition studies with extracts of B. tropicalis, D. pteronyssinus and A. suum, demonstrating that there is a high degree of cross-reactivity between these sources including protein IgE epitopes (24). Although carbohydrate epitopes can be involved (109), inhibition of IgE binding was also demonstrated using deglycosylated extracts and nonglycosylated recombinant allergens. Using sera from patients with asthma, our experiments strongly suggest that mites are the primary sensitizers and that clinically relevant allergens such as tropomyosin and glutathione transferases are involved. Although, as suggested, the clinical relevance of cross-reactivity between parasites and house dust mites in tropical regions needs to be demonstrated (109,110), we postulate that the high prevalence of IgE antibodies to mites observed in tropical populations is partially the result of cross-reactivity with Ascaris allergens. Also, the high prevalence of allergy observed in urban areas of the tropics, even in places with poor hygienic conditions, may be influenced by the same phenomenon.

For the past 20 years, to study human IBD mechanistically, a number of murine models of colitis have been developed. These models are indispensable tools to decipher underlying mechanisms of IBD pathogenesis as well as to evaluate

a number of potential therapeutics. Among various chemically induced colitis models, the dextran sulfate sodium (DSS)-induced colitis model is widely used because of its simplicity and many similarities with human ulcerative colitis. This model has both advantages and disadvantages that must be considered when employed. This LY2157299 protocol describes the DSS-induced colitis model, focusing on details and factors that could affect DSS-induced pathology. Curr. Protoc. Immunol. 104:15.25.1-15.25.14. © 2014 by John Wiley & Sons, Inc. “
“Immunoglobulin (Ig) therapy is the mainstay for treatment

in the majority of primary immune deficiencies. While B cell defects are the predominant conditions in man, other diseases in which T cell dysfunction is severe also require antibody replacement. In many medical practices the phenotypic overlap between immune deficiency and symptoms of asthma leads to both missed opportunities for diagnosing immune defects and inappropriate Ig treatment of asthmatic patients with Chk inhibitor normal B cell function. As steroid therapy can lower serum IgG levels, this finding alone is an insufficient indicator for Ig replacement. In the past 3 decades, there has a gradual increase in recommended and commonly used doses of parenteral immune globulin, often based on both IgG trough levels and clinical responses. Special attention to Ig doses is needed for growing children, in cases of weight loss or gain, pregnancy and for subjects in

whom more Chlormezanone rapid consumption of Ig is likely, including febrile patients or those with gastrointestinal or lung disease. While acute bacterial infections are much less common in Ig-treated subjects, a number of reports note continued evidence of inflammatory complications. Monitoring patients over time includes, at minimum, physical examination, blood counts and chemistry screening tests and IgG trough levels, at 6–12-month intervals. Other monitoring tools include spirometry and at wider intervals with those with lung disease, carbon monoxide diffusion capacity and chest computed tomography scans. With careful selection of patients and adequate therapy, an improved quality of life is possible. In the past 3 decades, replacement immune globulin (Ig) therapy has become the standard of care in patients with primary and secondary antibody defects [1–3]. While many studies have described this advance in medical care, the increasing number of patients on this therapy, and diversity of physicians in various specialities who care for them, suggests that practical guidelines for the use of Ig may be of use. The current paper outlines an approach to achieve successful therapy with Ig in patients with primary immune defects.

Positive staining cut-off was determined in comparison to the control isotype (clones 27–35; BD Biosciences) following the manufacturer’s instructions

(BD Biosciences). For each patient, genomic DNA was isolated by the phenol–chloroform method [21] from a whole blood sample collected on the day of the liver biopsy. click here Twenty nanograms of DNA were used to assay CCL2 rs1024611 A > G with the TaqMan assay ID C_2590362_10 and CCR2 190 A/G rs1799864 assays (Applied Biosystems, Foster City, CA, USA) on a LightCycler® 480-real-time PCR System (Roche Diagnostics GmbH, Mannheim, Germany). We included DNA samples of known genotypes as internal positive and negative (water) controls to secure the genotyping procedure. Plates were run as follows: initial denaturation and enzyme activation at 95°C for 5 min, followed by 45 cycles of denaturation at 95°C for 15 s and annealing/extension at 60°C for 30 s. CCL2 rs1024611 polymorphism was determined by an allelic discrimination assay run on the LightCycler® 480-System

(Roche Diagnostics). Allele frequencies were in Hardy–Weinberg equilibrium. Data are expressed as medians (minimum–maximum). Multiple comparisons were performed using the Kruskal–Wallis test. The Mann–Whitney U-test was then used for Adriamycin mw post-hoc analysis. Non-parametric correlations were performed using the Spearman test. Results are shown as box-plots. Genotype frequencies are reported with their group percentages. A two-sided χ2 test was used for comparison of qualitative variables. Kaplan–Meir survival curves were compared using the log-rank test. A P-value <0·05 was considered statistically significant. Calculations were performed with spss version 17·0 software (Chicago, IL, USA). CCL2 plasma levels were increased in patients with ALD [229·7 (20·4–1563)

pg/ml; n = 122] compared to healthy subjects (HS) [139 (61·4–294·1) pg/ml; n = 10] (P = 0·003). Among ALD patients, those with AH had higher CCL2 plasma levels [284·5 (74·9–1563) pg/ml; n = 73] than those without AH [188·4 (20·4–523·2) pg/ml; n = 49] (P < 0·001), Fig. 1a. Patients with severe AH (Mdf ≥ 32) had higher CCL2 plasma levels than those with non-severe AH [368·2 (77·8–1563) pg/ml; n = 34]versus[245·8 (74·9–1371·4) pg/ml; n = 39] (P = 0·016), Fig. 1b. No difference in CCL2 plasma Inositol monophosphatase 1 levels was observed between patients with cirrhosis [226·6 (20·4–1563) pg/ml; n = 109] and those without [280·9 (109·1–523·2) pg/ml; n = 13] (P = 0·526). CCL2 plasma concentrations showed an association with parameters of liver disease severity (Table 2a). We also performed a qRT–PCR for CCL2 on mRNA extracts obtained from transjugular liver biopsies. CCL2 plasma levels were correlated with liver CCL2 mRNA (r = 0·288 P = 0·033). Liver CCL2 mRNA levels were higher in patients with AH [6·4 102 (44–1·1 104) mRNA copies/105 copies HPRT] than in those without AH [2·2 102 (3·5-2·4 103) mRNA copies/105 copies HPRT] (P < 0·005), Fig. 1c.

Therefore, this technique could be an effective and safe method for the treatment of cryptococcal meningitis. “
“Resveratrol is a natural stilbene synthesised by plants. This compound has been shown to inhibit the growth of Candida albicans TIMM 1768 efficiently. Till date, no information is available for other Candida species. The evaluation of the antimicrobial activity of resveratrol was analysed by the inhibition of the growth and metabolism assays. Our data indicate that resveratrol is not effective against Candida

albicans and non-C. albicans species (C. dubliniensis, C. glabrata, C. tropicalis, C. parapsilosis and C. krusei) in vitro. The potential candidacidal activity could not be confirmed. “
“The conflicts of interest (COI) statements for the following articles in Vol. 55, Suppl. 1 of Mycoses (first published: April 2012) were not inserted at time of print. The full COI statements have been provided below.  Hof, H. (2012), Pneumocystis jirovecii: find more a peculiar fungus posing particular problems for therapy and prophylaxis. Mycoses, 55(Suppl. 1): 1-7. doi: 10.1111/j.1439-0507.2011.02159.x The author served as speaker for Pfizer, MSD, Astellas, Gilead. The author has received research grants from

Merck, Pfizer, Astellas, T2 Biosystems and Gilead. He is also an ad-hoc advisor for Merck, Astellas, T2 Biosystems and Gilead. DPK has received research support and honoraria RGFP966 concentration from Schering-Plough, Pfizer, Astellas Pharma, Inc., Enzon Pharmaceuticals, and Merck this website and Co., Inc. NS and MG have no conflicts of interest to declare. AJU has served as a consultant for Astellas Pharma, Basilea, Gilead, MSD, Pfizer and the former Schering-Plough and has participated in speakers’ bureaus for Astellas Pharma, Gilead, MSD, Pfizer and the former Schering-Plough. WK

has no conflicts of interest to declare. “
“Invasive aspergillosis (IA) is an important cause of infectious morbidity and mortality in patients who undergo haematopoietic stem cell transplantation (HSCT). History of IA before allogeneic HSCT is still challenging because of the high risk of recurrence after HSCT. Recent advances in early-stage diagnosis and new, more effective classes of antifungal agents have improved the management of IA in the HSCT recipients. We report two cases with acute myelogenous leukaemia after primary failure of induction chemotherapy with the patients developing pulmonary IA. They responded well to a combination of voriconazole (VCZ) and micafungin, resulting in a remarkable reduction of pulmonary IA lesions at short intervals. Thereafter, antifungal therapy was switched to liposomal amphotericin B (L-AmB), followed by conditioning regimen for allogeneic HSCT, because of the possibility of VCZ altering the metabolism of chemotherapeutic agents and calcineurin inhibitors. Successful engraftment was achieved without severe adverse side-effects or aggravation of IA after HSCT.

When there is a suitable alternative, aminoglycoside use should be limited to avoid their adverse effects of nephrotoxicity and ototoxicity. Dual antibiotic therapy is indicated

for Pseudomonas spp. peritonitis. The use of antibiotics with catheter replacement is superior to antibiotics with urokinase to treat peritoneal dialysis-associated peritonitis (Evidence level II). The appropriate timing for reinsertion of a peritoneal dialysis catheter that has been removed because of peritonitis is not known. Anecdotal recommendations range from simultaneous removal and reinsertion to waiting for a minimum of three weeks after removal before reinsertion. No peritoneal dialysis catheter has proven to be superior to the two-cuff standard Tenckhoff catheter in the prevention of peritonitis (Evidence level II). Coiled-tipped catheters are associated with increased risk of technique failure as compared with straight-tipped LY2109761 order catheters (Evidence level II).

Laparoscopy for insertion of peritoneal dialysis catheters has been shown to have similar complication rates to laparotomy (Evidence level I). Peritoneoscopic insertion of peritoneal dialysis catheters may be superior to dissective insertion in the prevention of peritonitis, leaking of peritoneal dialysis fluid around the cuff and technique failure (Evidence level II). Peritoneal dialysis catheters should selleck inhibitor be inserted by experienced operators working as part of a multidisciplinary team as this is associated with low reported infectious complication rates. Intravenous antibiotic prophylaxis should be used prior to peritoneal dialysis catheter insertion to reduce the risk of early peritonitis almost (Evidence level I). Vancomycin, cephalosporins and gentamicin have demonstrated effectiveness in reducing the risk of peritonitis (Evidence level II). Protocols for antibiotic prophylaxis prior to catheter insertion should be guided by local infectious disease guidelines and local bacterial resistance profiles. Vancomycin use should be restricted to avoid emerging vancomycin-resistant enterococci (VRE) and Staphylococcus aureus (VRSA). Vancomycin use should be guided by the

infectious disease guidelines of individual treatment units. No recommendation possible based on Level I or II evidence. Commencement of peritoneal dialysis should preferably be delayed until 14 days after catheter placement. This is to reduce the risk of dialysate leakage, subsequent infections as well as mechanical complications. Early initiation of peritoneal dialysis had no demonstrable impact on infection risk in various trials. It is also possible to initiate peritoneal dialysis early in the presence of uraemia to avoid bridge haemodialysis and emergency use of central venous catheters. If an early start is attempted, then small dialysate dwell volumes should be used, preferably using a cycler in the recumbent position.

Medium was changed on days 3 and 5 and usually 7-day-old cultures were used for experiments. For cytokine measurement, sorted lung DC or BMDC were pulsed with OVA or OVA-IC (see below) for 45 min or 48 h, respectively. Then supernatant was harvested and IL-6 and TNF-α determined using a commercial available Cytometric Bead Array (BD Biosciences, Germany) according to the manufacturer’s instructions. For stimulation of OT-II or DO11.10 cells, single cell suspensions from the LN were treated with monoclonal antibodies against MAC-1, F4/80, erythroid cells, Gr-1, MHC

class II and CD8α. The antibody-coated cells were incubated with anti-rat IgG-coupled magnetic beads (Biomag® Quiagen, Germany) following the manufacturer’s protocols. Finally, enriched T cells were labeled with CFSE as described elsewhere 6. For Seliciclib the experiments using soluble OVA (Grade VI, Sigma or EndoGrade

OVA, endotoxin LBH589 in vivo conc.<1 EU/mg, Hyglos, Germany) or OVA-IC, DC were plated in U-bottom 96-well plates (1×104 cells/well in RPMI 1640 supplemented with 10% FBS and 25 mM HEPES) with 25 μg/mL OVA or OVA-IC (made by mixing a 1:4 ratio of 25 μg/mL OVA and anti-OVA IgG) for 45 min at 37°C in complete medium. A Limulus Amebocyte Lysate revealed that OVA grade VI (Sigma) had a non-significant endotoxin content of <0.1 EU at a concentration of 100 μg/mL, that the EndoGrade™ OVA (100 μg/mL) was endotoxin free with no signal in the Limulus Amebocyte Lysate assay, and that the anti-OVA IgG at a concentration used in our experiments had an endotoxin level of 0.24 EU. The DC were washed three times and co-cultured in 200 μL of complete medium containing 5×104 CFSE-labeled OT-II or DO11.10 cells. For experiments using OVA in

combination with serum from sensitized (OVA or BSA) or non-sensitized mice, 1×104 lung DC were incubated with OVA (25 μg/mL) and serum (100 μL) for 1 h at 37°C. Afterwards, OVA and serum were removed by washing the cells with PBS and DC were used to stimulate 5×104 CFSE-labeled OT-II cells in 200 μL Mephenoxalone of complete medium. For proliferation analysis after 60 h of culture, OT-II or DO11.10 cells were stained with CD4-APC (BD Biosciences, Germany), and samples were analyzed by flow cytometry. The total number of dividing (CD4+PI−CFSElow) cells was determined in duplicate. For some experiments with OVA-IC, the data are presented as fold increase above T-cell proliferation obtained with OVA-pulsed DC in order to normalize for variability among experiments. Twenty-four hours after the last allergen challenge, airway hyperresponsiveness to inhaled methacholine (MCh) was assessed. Invasive but repetitive technique was performed to measure lung function in orotracheally intubated mice, using a body plethysmograph (HSE-Harvard Apparatus, March-Hugstetten, Germany) and an inhalation unit, which has been designed specifically for this mouse model 39.

Cells were washed with PBS, fixed with 1% formaldehyde

in PBS and analysed using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA). A mouse IgG2b FITC-conjugated antibody was used as an isotype control for unspecific intracellular staining (BD Biosciences). Splenic CD11c+ DCs, CD11b+ macrophages/monocytes Epigenetics inhibitor and CD4+ T cells from C57BL/6J FcγRIIb−/− and C57BL/6 mice at 1 year old were stained either with anti-mouse CD11c-APC, anti-CD11b-PE or anti-mouse CD4-APC antibodies. After surface staining, cells were fixed (PBS/formaldehyde 1%) and incubated with FITC-conjugated anti-HO-1 antibody in permeabilization buffer overnight. Cells were then washed and fixed in PBS/formaldehyde 1%. The expression of surface markers and HO-1 was determined by FACS. The PBMCs obtained after Ficoll separation were stained with PE-conjugated and APC-conjugated monoclonal antibodies against CD14 and CD4, respectively, for 30 min at 4°. Staining for both CD14 and CD4 allowed clear separation of populations and minimized cross-contamination.

After incubation with antibody conjugates for 20 min Hedgehog antagonist on ice, cells were washed twice in PBS/1% BSA and sorted using a FACSAria II (Becton Dickinson). Purity of CD4+ and CD14+ cells was always higher than 95% after sorting. RNA from CD4+ and CD14+ sorted population and PBMCs stimulated for 24 hr with 1 μg/ml LPS, 3 μg/ml methyl prednisolone and Cobalt-Protoporphyrin 1 μm, were extracted using Trizol (Invitrogen, Carlsbad, CA) according

to the manufacturer’s instructions. Reverse transcription PCR and cDNA synthesis were performed using random IMP dehydrogenase primers (ImProm-II; Promega, Madison, WI). Real-time PCR reactions were carried out using a Strategene Mx300P thermal cycler. Briefly, cDNAs amplified out of total RNA from CD4+ and CD14+ cells, were tested for amplification of HO-1 using the following primers (5′–3′): forward AGGCAGAGGGTGATAGAAGAGG, and reverse TGGGAGCGGGTGTTGAGT. The PCR amplification of glyceraldehyde 3-phosphate dehydrogenase (GADPH) or hypoxanthine phosphoribosyltransferase (HPRT) was used as an internal control. To corroborate amplification specificity, PCR products were subjected to a melting curve program. Abundance of HO-1 mRNA was determined from standard curves (correlation coefficient ≥ 0·98). Results were expressed as the ratio of the HO-1 amount relative to the amount of GADPH or HPRT for each sample, determined in duplicate experiments. The PBMCs were seeded at 106 cells per well and incubated with SEA for 36 hr. In some experiments, PBMCs were incubated with SEA (50 nm) and stained with APC-conjugated anti-CD4, PerCP-conjugated anti-CD69, PE-conjugated anti-IL-2 (permeabilized) and FITC-conjugated anti-CD25. The PBMCs were also incubated with different SEA concentrations (0·16 pm to 1 μm) for 36 hr and stained with APC-conjugated anti-CD4 and PerCP-conjugated anti-CD69. Data and statistical analyses were performed using prism 4 software (Graph Pad Software, Inc.