Fast learning of sequential motor tasks modulates regional brain activity in the dorsolateral prefrontal cortex (DLPFC), primary motor cortex (M1), and presupplementary motor area (preSMA) (Floyer-Lea and Matthews, 2005 and Sakai et al., 1999), which show decreased activation as learning progresses, and in the premotor cortex, supplementary motor area (SMA),

parietal regions, striatum, and the cerebellum, which show increased activation with learning (see Figure 3; Grafton et al., 2002, Honda et al., 1998 and Floyer-Lea and Matthews, 2005). Thus, learning is associated with differential regional modulation of blood oxygenation level-dependent (BOLD) activity or regional cerebral blood flow (rCBF). Increasing activation is thought to reflect recruitment Pexidartinib supplier of additional cortical substrates with practice (Poldrack, 2000). Decreasing activation, on the other hand, suggests that the task can be carried out using fewer neuronal resources as fast learning proceeds http://www.selleckchem.com/products/AZD2281(Olaparib).html (Poldrack, 2000). A valuable framework for interpreting the role of this complex pattern of recruitment has been proposed by Hikosaka and colleagues

(Hikosaka et al., 2002a) in a model describing the mechanisms for sequential motor skill learning. According to this model, two parallel loop circuits operate in learning spatial and motor features of sequences. Whereas learning spatial coordinates is supported by a frontoparietal-associative striatum-cerebellar circuit, learning motor coordinates is supported by an M1-sensorimotor striatum-cerebellar circuit. Transformations

between the two coordinate systems rely, according to this model, on the contribution of the SMA, pre-SMA, and premotor cortices. Importantly, it was argued that learning spatial coordinates is faster, yet requires additional attentional and executive resources, putatively provided by prefrontal PDK4 cortical regions (Miller and Cohen, 2001). Similarly, in another model, Doyon and Ungerleider (2002) proposed that during fast learning a cortico-striato-thalamo-cortical loop and a cortico-cerebello-thalamo-cortical loop are both recruited, operating in parallel. Further, interactions between the two systems were believed to be crucial for establishing the motor routines necessary for learning new motor skills (Doyon and Ungerleider, 2002 and Doyon and Benali, 2005). Both models share the view that motor skill learning involves interactions between distinct cortical and subcortical circuits, crucial for the unique cognitive and control demands associated with this stage of skill acquisition (Hikosaka et al., 2002a and Doyon and Ungerleider, 2002). One of the key brain regions involved in fast learning is M1. Fast motor skill learning is associated with substantial recruitment of neurons in M1 in behaving mice during the initial stages of learning an accelerating rotarod task (Costa et al.

e., recall-related activity (Figure 4B). It is instructive to consider how that neuronal activity relates to perceptual state under different imagery conditions. The studies of recall-related neuronal activity Lapatinib chemical structure in areas IT and MT summarized above were conducted under conditions deemed likely to elicit explicit imagery. For example, from

the study of Schlack and Albright (2007) one might suppose that the thing recalled (a patch of moving dots) appears in the form it has been previously seen and serves as an explicit template for an expected target. Under these conditions, the image may have no direct or meaningful influence over the percept of the retinal stimulus that elicited it. Correspondingly,

the observed recall-related activity in area MT may have no bearing on the percept of the arrow stimulus that was simultaneously visible. It seems likely, however, that the retrieval substrate that affords explicit imagery is more commonly—indeed ubiquitously—employed for implicit imagery, which is notable for its functional interactions with the retinal stimulus. Indeed, one mechanistic interpretation of the claim that perceptual experience falls routinely at varying positions along a stimulus-imagery continuum is that bottom-up stimulus and top-down recall-related signals are not simply coexistent in visual cortex, C59 wnt molecular weight but perpetually interact to yield percepts of “probable things. This mechanistic proposal can be conveniently fleshed-out and employed to make testable predictions following the logic that Newsome and colleagues (e.g., Nichols and

Newsome, 2002) have used to address the interaction between bottom-up motion signals and electrical microstimulation of MT neurons. (This analogy works because microstimulation can be considered a crude Adenylyl cyclase form of top-down signal.) As illustrated schematically in Figure 6, bottom-up (stimulus) and top-down (imaginal) inputs to area MT should yield distinct activity patterns across the spectrum of direction columns (Albright et al., 1984). According to this simple model, perceptual experience is determined as a weighted average of these activity distributions (an assumption consistent with perceived motion in the presence of two real moving components [Adelson and Bergen, 1985, Qian et al., 1994, Stromeyer et al., 1984 and van Santen and Sperling, 1985]). Under normal circumstances, the imaginal component—elicited by cued associative recall—would be expected to reinforce the stimulus component, which has obvious functional benefits (noted above) when the stimulus is weak (e.g., Figure 6C). Potentially more revealing predictions occur for the unlikely case in which stimulus and imaginal components are diametrically opposed (Figure 6A). The resulting activity distribution naturally depends upon the relative strengths of the stimulus and imaginal components.

6). Regions of interest (ROI) extraction, background subtraction, and

brightness normalization (ΔF/F0) were performed in Igor Pro 6.2 and facilitated by SARFIA analysis routines (Dorostkar et al., 2010). Fluorescence traces were then sorted and analyzed by custom-made scripts and NeuroMatic. The detection of active ROI in the IPL high throughput screening assay was based on the thresholding of the Laplacian Transform of the two-photon recordings. In this way, responding bipolar cell terminals and active areas of the ganglion cell dendrites were identified in ribeye::SyGCamp2 and eno2::GCamp3.5 fish, respectively. The responses to light of bipolar cell terminals and retinal ganglion cell dendrites were characterized according to their response amplitude, i.e., the variation in fluorescence during stimulation in comparison to baseline (ΔF/F0). Responses to CH5424802 light were plotted in full, as in Figure 1B, left, or in stimulus versus amplitude plots (e.g., Figure 1B, right). In the case of traces representing single terminals (e.g., Figure 1B), the error curve (gray shadow in Figure 1B) represents the SEM of the four trials employed to assess the terminal responsiveness (see

Stimulation Protocols). In the case of traces representing whole populations of terminals (e.g., Figure 1D), the error curve represents the standard error of all the responses employed to generate the final average. As described in the stimulation protocols section, a stimulus could be light intensity, contrast, or frequency. Intensity versus amplitude plots were obtained by averaging amplitude values over 300 ms long time windows

around the maximum response occurring during the stimulation time (e.g., Figure 1B, right). Contrast versus amplitude and frequency versus amplitude plots were obtained by averaging amplitude values over the whole stimulation period (e.g., Figures 2B and S2D, respectively). The intensity versus amplitude plots were fitted with Hill curves, in the form A = Ih/Ih + I1/2h, A being the response amplitude, I the stimulation intensity, h the Hill coefficient, and I1/2 Thymidine kinase the sensitivity at half maximum, i.e., the stimulation intensity that elicits half of the maximum response. I1/2 has been used as a metric for the sensitivity of each intensity versus amplitude curve. Contrast versus amplitude plots were fitted with power functions, in the form A = k × Cα being A the response amplitude, k a constant, C the stimulation contrast, and α the power exponent. The sensitivity shift induced by olfactory stimulation for each individual terminal (e.g., Figure 1F) was measured by comparing the values of the lowest light intensity eliciting a statistically significant response before and after methionine administration. The statistical significance of a response was assessed by comparing (t test) the average calcium level during light stimulation with a threshold defined as three times the SD of a baseline epoch.

The cDNA was amplified with forward, tcttgcaaggacagttgcac, and reverse, tcaggcacttgtctcacagc, primers bracketing nucleotides 248–629 in the open reading frame of chicken prestin (GenBank accession number EF028087.1; Schaechinger and Oliver 2007) using Invitrogen Platinum Taq DNA Polymerase (Life Technologies). As a positive control, 200 ng/μl of pEGFP-N1 plasmid containing chicken prestin (Schaechinger and Oliver, 2007; Tan et al., 2011) Apoptosis Compound Library research buy was also amplified with the same primer set. PCR products were electrophoresed on 1% agarose gel. A polyclonal antibody against the N-terminal peptide sequence of rat prestin, CKYLVERPIFSHPVLQE (Bethyl

Laboratories), which is closely homologous to the equivalent sequence in chicken prestin, was used to label the basilar papilla. The antibody was affinity purified and shown to immunolabel rat OHCs (Mahendrasingam et al., 2010). Immunoblots were performed on tissue from fifteen E19 chicken papillae and twelve P11 mice cochleas; mice were decapitated and cochleas dissected out using procedures approved by the Institutional Animal Care and Use Committee of the University of Wisconsin-Madison. Proteins were extracted with Tissue Extraction Reagent I (Invitrogen Life Technologies) plus protease inhibitor Y-27632 concentration cocktail (Sigma-Aldrich), denatured and electrophoretically separated

on a 7.5% SDS-PAGE and blotted onto a 0.45 μm nitrocellulose membrane. Blotted membranes were incubated with the prestin antibody (1:100 dilution) at 4°C overnight then incubated in secondary goat anti-rabbit horseradish L-NAME HCl peroxidase-conjugated antibody (1:1000, Invitrogen) for 90 min at room temperature and stained with Novex chemiluminescent reagent. Chicken papillae were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) for 30 min, washed then permeabilized with 0.5% Triton-X for 30 min. Fixed papillae were immersed in 10% goat serum (Invitrogen) for 1 hr at room temperature and incubated overnight at 4°C with

the prestin antibody (dilution 1:50) and the mouse monoclonal HCS-1 antibody (dilution 1:400) which labels otoferlin in chicken hair cells (Goodyear et al., 2010). After rinsing in PBS, specimens were incubated with Alexa Fluor 488 goat anti-rabbit IgG antibody (1:200; Invitrogen) and goat anti-mouse Alexa Fluor 568 for 90 min and Alexa Fluor 647 phalloidin (1:200; Invitrogen Life Sciences) for 60 min at room temperature. Preparations were mounted in Fluoromount-G medium (SouthernBiotech) with coverslips and viewed under a 60× oil-immersion objective (NA = 1.4) on a Nikon A1 laser scanning confocal microscope. Work was supported by grant RO1 DC01362 from the National Institutes on Deafness and other Communication Disorders to R.F. We thank Dan Yee for constructing electrical equipment, Ana Garic for assistance with molecular biology, Lance Rodenkirch for advice on confocal imaging, Dominik Oliver for the pEGFP-N1 plasmid containing chicken prestin, and Jeff Corwin for the HCS-1 antibody.

, 1984). In cats, lesions of the flocculus abolish Vestibuloocular reflex adaptation (Luebke and Robinson, 1994). The rate of rotation adaptation in humans is increased by anodal transcranial direct current stimulation over the ipsilateral cerebellum but not over primary motor cortex (Galea et al., 2011). Visuomotor adaptation is not disrupted by lesions

in the corticospinal tract caused by ischemic stroke in humans (Reisman et al., 2007, Scheidt and Stoeckmann, 2007 and Scheidt et al., 2000) and is largely unaffected in Parkinson’s disease (PD) (Bédard and Sanes, 2011 and Marinelli et al., 2009) and Huntington’s disease (Smith Pexidartinib supplier and Shadmehr, 2005). Thus, motor cortex, the corticospinal tract, and

the basal ganglia do not seem to be necessary structures for visuomotor adaptation. Subtleties and controversies arise, however, because abnormalities in adaptation paradigms have been seen in patients who do not have known cerebellar impairment and patients with cerebellar disease can reduce errors under certain experimental conditions. We shall discuss these in turn and provide potential explanations that show why these exceptions do not disprove the cerebellar hypothesis for adaptation. In two recent studies, patients with PD were able to adapt to a rotation as well Selleck CP690550 as age-matched controls but did not show savings in re-exposure (Bédard and Sanes, 2011 and Marinelli et al., 2009). We have recently argued that savings in adaptation paradigms is not due to forward model-based error reduction but is instead Oxalosuccinic acid attributable to an addition operant process (Huang et al., 2011). Using this new framework, we can explain the result in PD because it is known that operant learning is disrupted in these patients (Knowlton et al., 1996). Patients with stroke in the left superior parietal lobule showed markedly impaired ability to adapt to a visuomotor rotation (Mutha et al., 2011), which would appear to contradict the idea that the cerebellum is the (sole) locus for adaptation. We have recently argued, however, that the parietal cortex receives the output of a

cerebellar forward model, which is then integrated with peripheral sensory feedback (Tanaka et al., 2009). Thus, the parietal cortex may be the downstream target of the cerebellum and thus disruption of this target can impair adaptation. A recent study reported that patients with spinocerebellar ataxia type 6 were able to adapt to an incremental introduced forcefield but not if the forcefield was introduced as a large step (Criscimagna-Hemminger et al., 2010). There are two ways to interpret these data. One is that adaptation to small errors is carried out in a noncerebellar structure. Alternatively, these patients brought down error using a non-adaptation-based mechanism. There is direct and indirect support for the second interpretation.

Based on these observations, the first node either indirectly facilitates high-frequency bursts by generating an inward current at subthreshold potentials or directly initiates APs within a burst. APs during a high-frequency burst are known

to be generated in the axon, but the role of the first node has not been precisely determined (Williams and Stuart, 1999). Rare cases of initiation of APs in the first node have been reported in Purkinje axons (Palmer et al., 2010). To distinguish between the AIS and the node as possible initiation sites, axosomatic delays during high-frequency bursts were determined by making extracellular action potential (eAP) recordings simultaneously from both locations in combination with whole-cell Selleck Target Selective Inhibitor Library somatic recording (Figure 5A). Using fluorescence-guided axon visualization, patch-pipettes filled with extracellular

solution were placed check details near the end of the AIS (on average 40 ± 3 μm) and at the first node of the same axon (162 ± 34 μm distance from the soma). AP bursts were triggered with somatic suprathreshold current injections in IB neurons (98–211 Hz, n = 5). APs within a burst were separately averaged (40–80 trials) by alignment to the onset of the somatic AP (first peak in the d2V/dt2, Figure 5B). The results show that for the first spike in a burst, the eAP onset latency in the AIS was on average −74 ± 9.8 μs (range from −38 to −93 μs, n = 5) and preceding the eAP at the first node (+14 ±

10 μs, p < 0.01, n = 5, Figures 5B and 5C). For each paired recording, the AIS-to-node latency was negative (range from −30 to −110 μs, average −87 ± 16 μs, n = 5), indicating that the first AP within a high-frequency burst is starting in the AIS. This spatiotemporal sequence was almost identical for the second AP in the burst (AIS-to-node latency, −136 ± 20 μs, n = 5, p < 0.01, Figures 5B and 5C). Furthermore, in one case of an AP burst with three spikes, the third AP also had a negative AIS-to-node latency (−148 μs), suggesting spike initiation is robust in the AIS. Based on the distances between recording sites, the AIS-to-soma antidromic conduction velocity was estimated to be 0.67 ± 0.10 m s−1 and 1.48 ± 0.37 m s−1 for the orthodromic propagation through the first internode (n = 5). Thus, all APs Mannose-binding protein-associated serine protease during high-frequency firing are initiated in the AIS, and the importance of the first branchpoint is likely to be indirect (e.g., through a conductance active in the subthreshold voltage range). Voltage-gated Na+ channels are known to produce three types of currents, operationally defined by their distinct kinetics: a large and fast-inactivating Na+ current underlying the AP upstroke (INaT), a transient resurgent current activated during repolarization (INaR), and a noninactivating persistent current active in the subthreshold range (INaP). Since nodes of Ranvier contain a high density of Na+ channels ( Caldwell et al.

, 1988). Bilateral recording at one segmental level is considered to be a proxy for properties of left-right alternation, whereas coincident

ipsilateral recording from ventral roots at lumbar segmental levels L2 and L5 is used to measure properties of flexor-extensor alternation. This widely used assay has been extremely valuable since it allows a first assessment of motor defects in an isolated preparation by activation of local spinal circuits through the ON 1910 application of combinatorial drug cocktails mimicking descending input (5-HT, dopamine, NMDA) or by electrical stimulation of descending tracts or sensory fibers. It also allows for the tractable interrogation of circuit-level effects of genetic perturbations that are pre- or postnatally lethal. However, while left-right alternation assessed by ventral root recordings can be considered to be a straightforward readout, credible parameters for extensor-flexor alternation may be more difficult to acquire. L2 ventral roots burst in alignment with flexor muscle contractions and L5 bursts align with extensor muscle activity, but the significance of this coincidence is unclear since L2 and L5 roots both contain axons innervating extensor and flexor muscles. This may also explain the conspicuous rarity of extensor-flexor Protease Inhibitor Library phenotypes in neonatal fictive locomotion assays

of mutant mice when scoring for

L2-L5 burst alternation defects, and more refined in vitro assays may be needed to extract information. In summary, to get definitive answers on the functional role of defined spinal subpopulations in movement, it is essential to combine in vitro with in vivo assays, in which neural pathways feed spatially, temporally, and quantitatively accurate information into the system. The high degree and complexity of neuronal diversification in the spinal cord suggests that developmental mechanisms in addition to progenitor domain origin are probably involved in subpopulation specification. Early findings have demonstrated that temporal gradients of neurogenesis progress along the ventrodorsal and rostrocaudal Megestrol Acetate axis in the spinal cord (Nornes and Carry, 1978). As such, it is interesting to ask whether this neurogenic gradient may influence neuronal diversification in spinal circuits. Pulse-chase labeling experiments can track neurons born during defined developmental time windows to later stages to assess molecular markers, connectivity, and function. One of the earliest observations of differences in birthdating according to progenitor domain territory in the mouse spinal cord was described for Lbx1on dI4–dI6 neurons that separate into two waves of early- and late-born neurons (Gross et al., 2002) (Figure 2A, above timeline).

Interestingly, the nuclear HDAC5 puncta colocalized with endogenous MEF2 proteins (see Figure S1A available

online), suggesting that the nuclear HDAC5 is associated with transcriptional complexes on genomic DNA and that previously noted cAMP-dependent suppression of MEF2 activity is likely mediated by HDAC5 (Belfield et al., 2006 and Pulipparacharuvil Ponatinib in vitro et al., 2008). We speculated that cAMP signaling might regulate nuclear accumulation by regulating HDAC5 phosphorylation. By in silico analysis of the HDAC5 primary amino acid sequence, we identified a highly conserved serine (S279) that was a candidate substrate for protein kinase A (PKA) or cyclin-dependent kinase 5 (Cdk5), both of which are implicated in drug addiction-related behavioral adaptations (Benavides et al., 2007, Bibb et al., 2001, Pulipparacharuvil et al., 2008 and Self et al., 1998). Because S279 resides within the HDAC5 NLS, which is characterized by a high density of basic residues (Figure 1C, noted by asterisks), we speculated that phosphorylation at this site may modulate nucleocytoplasmic localization of HDAC5. The HDAC5 S279 site (and surrounding residues) was highly conserved from fish to humans (Figure 1C)

and in both HDAC4 and HDAC9. Tandem mass spectrometry analysis of flag-epitope tagged HDAC5 in cultured cells revealed a singly phosphorylated peptide (SSPLLR: 278–283 LY2109761 manufacturer amino acids) (Figure S1B). Therefore, we generated a phosphorylation site-specific antibody against HDAC5 S279 to study its regulation by cAMP signaling. The P-S279 peptide antibody recognizes wild-type (WT) HDAC5, but not a mutant form that cannot be phosphorylated at this site (HDAC5 S279A) (Figure 1D). It also recognizes endogenous P-HDAC5 after immunoprecipitation (IP) of total HDAC5 from cultured striatal else neurons or adult striatal tissues, but not from anti-HDAC5 IPs using HDAC5 knockout (KO) mouse lysates (Figure S1C) (Chang et al., 2004), indicating that endogenous HDAC5 is basally phosphorylated at S279 in striatum in vitro and in vivo.

To determine whether Cdk5 or PKA can phosphorylate HDAC5 S279, we incubated full-length, dephosphorylated HDAC5 with recombinant Cdk5/p25 or PKA in vitro and found that either kinase can phosphorylate S279 in vitro (Figures S2A and S2B). However, when we incubated striatal neurons with specific kinase inhibitors for either Cdk5, PKA or p38 MapK (all potential kinases predicted for S279), we observed dramatically reduced P-S279 levels in the presence of Cdk5 inhibitors (Figures 2A and S2C) but observed no change in P-S279 in the presence of PKA or p38 MapK inhibitors (Figure S2C). Together, these findings indicate that whereas PKA is able to phosphorylate HDAC5 in vitro, it is not required for endogenous HDAC5 P-S279 in striatal neurons.

S. Centers for Disease Control and Prevention for helpful comments on the manuscript; Ana Rita de Cássia L. Vasconcelos and, most of all, the immunization program team of the Municipal Health Department of Salvador, Brazil. This study was supported by grants from the Bahia State Foundation for the support of research (PP-SUS0001/2009) and National Program of Post-doctoral (CAPES-PNPD 1472/2008). “
“Human papillomavirus (HPV) vaccines have the potential to significantly reduce the incidence of cervical cancer, the leading cause of cancer mortality among women in sub-Saharan Africa [1] and [2]. Two HPV vaccines have

RAD001 now been approved for use in many countries. These provide a high degree of protection against HPV 16/18 infections and associated cervical lesions [3], [4] and [5]. The World Health Organisation recommends offering HPV vaccine to girls at ages 9–14, prior to sexual debut, since the vaccine has highest efficacy if girls have not already acquired

HPV [6]. Many high-income countries and some middle-income countries have started national HPV vaccination programs, either school-based or on-demand programs, with vaccine coverage (completion of the 3-dose regimen) inhibitors ranging from 9% (Greece) to 32% (US) and 76% (UK) [7], [8], [9] and [10]. Afatinib mouse In sub-Saharan Africa, two vaccine demonstration projects have been completed [11] and [12]; Rwanda has embarked on a national HPV vaccination programme [13] and [14], and Tanzania plans to start a similar programme in 2012. Research in Africa on HPV vaccine acceptability and delivery is needed to understand how best to deliver this vaccine to adolescent girls among populations who have little or no knowledge about cervical Rolziracetam cancer, and may be suspicious of vaccines that target young women or a sexually transmitted infection (STI) [15], [16], [17], [18], [19], [20], [21] and [22]. Between August 2010 and June 2011, in preparation for a national HPV immunisation program, a phase IV cluster-randomised trial (NCT01173900) in schoolgirls in Mwanza Region, Tanzania, was conducted to measure the

feasibility, uptake, and acceptability of two school-based HPV vaccine delivery strategies: age-based (all girls born in 1998) or class-based (all girls in Year 6 of primary school in 2010) [12]. We present findings from a qualitative sub-study conducted before the actual HPV vaccination started in August 2010. The sub-study’s objectives were to learn what people knew about cervical cancer and HPV vaccination, whether they would find HPV vaccination acceptable, and how they viewed vaccine delivery and consent procedures. These findings were used to improve sensitisation and vaccination procedures within the trial and to assist preparations for a national HPV vaccination program. The qualitative sub-study study took place in the two districts of Mwanza city and a neighbouring rural district (Misungwi), between March and August 2010.

Such strategies require accurate and comprehensive measurement of inhibitors balance ability. The Berg Balance Scale was developed in 1989 using health professional and patient interviews, which explored the various methods used to assess balance.4 Thirty-eight component balance tests were originally selected and then refined through further interviews and trials to 14 items, each scored from 0 to 4, making a possible total score between 0 and 56, with a higher score indicating better balance. Although the Berg Balance Scale was originally developed to measure balance in the elderly, it has since been

used to measure balance in a wide variety of patients. The convergent validity of the Berg Balance Scale has CP-868596 chemical structure been established across several different domains. Hospital inpatients with a lower Berg balance

score have been found to have a significantly higher chance of being discharged to nursing home accommodation.5 Among community-dwelling veterans, progressively lower Berg Balance Scale scores are associated with increased risk of injurious falls.3 Responsiveness to change was established in a trial enrolling sedentary older people, where those who exercised improved their Berg Balance Scale scores and reported fewer falls, compared to a control group.6 The Berg Balance Scale also had greater ability than four other performance measures to predict the onset of difficulty in activities of daily living in older adults.7 Normative data are important when interpreting any balance tool, both for

clinicians and researchers. Knowledge that a person or a group of people has significantly worse balance than a healthy person ATM Kinase Inhibitor mouse of the same age may assist the identification and effective management of balance problems. The effect of interventions to improve balance can be assessed by comparison to normative data for balance from healthy elderly people in specific age cohorts. Knowledge of the variability of the Berg Balance Scale in groups of healthy elderly people can be used to interpret individual results and to help establish the sample sizes required for future studies. An earlier review8 searched for the phrase ‘Berg Balance Scale’ and, despite finding 511 articles, did not identify any published review of normative data of the Berg Balance Scale. The study questions for the systematic review were: 1. What is the mean Berg Balance Scale score of healthy Chlormezanone elderly people living in the community and how does it vary with age? A literature search was undertaken to locate all relevant published studies. Electronic searches of MEDLINE, CINAHL, Embase, and the Cochrane Library databases from 1980 to September 2012 were conducted using ‘Berg Balance Scale’ as the search term. No keywords related to intervention type or health condition were used and no methodological filters to identify particular study designs were used. All potentially relevant papers were identified by screening the abstracts and assessed for inclusion.