In this population, we estimated the fraction of time the patients had a VL above 1000 copies/mL although the previous VL had been undetectable. The study was a prospective nationwide cohort study. Denmark had a population of 5.5 million as of 31 December 2007, with an estimated HIV prevalence of approximately 0.07% in the adult population [6,7]. Patients with HIV infection are treated in one of the country’s eight specialized

medical centres, where they are seen on an out-patient basis at intended intervals of selleck screening library 12 weeks. Antiretroviral treatment is provided free of charge to all HIV-infected residents of Denmark. The national criteria for initiating HAART have previously been described [8]. The Danish HIV Cohort study (DHCS), described in detail elsewhere, is

a population-based prospective nationwide cohort study of all HIV-infected individuals 16 years or older at diagnosis and who have been treated at Danish HIV centres after 1 January 1995 [8]. Patients are consecutively enrolled, and multiple registrations are avoided through the use of a unique 10-digit civil registration number assigned to all individuals in Denmark at birth or upon immigration. Data are updated yearly and include demographics, date of HIV infection, AIDS-defining events, date and cause of death and antiretroviral treatment. CD4 cell counts and HIV RNA measurements were extracted electronically from laboratory data files. All VL analyses used in the study period were designed to measure VL<50 copies/mL. The cohort database also includes data on partnership and sexual behaviour Navitoclax order for some of the patients. As of 31 December 2007, the cohort included 4792 Danish residents. From the DHCS we included all HIV-1-positive patients who were on HAART, had a minimum of two VL tests and had at least one episode with VL <51 copies/mL for more than six consecutive months between 1 January 2000 and 1 January 2008.

The study model was based on the following oxyclozanide assumptions. 1 Patients with a VL≤1000 copies/mL are at low (negligible) risk of sexually transmitting HIV. We calculated the observation time from 6 months after the first VL<51 copies/mL to the date of: (1) the latest VL test <51 copies/mL before 1 January 2008; (2) the first VL>50 copies/mL; (3) the last VL test before antiretroviral treatment was stopped; (4) if there was an interval of more than 7 months between VL tests, the last VL test before this interval. Hence, patients with a VL test >50 and ≤1000 copies/mL were censored without contributing time at risk of transmitting HIV. Time at risk of transmitting HIV was calculated as 50% of the time from a previous VL<51 copies/mL to a following VL>1000 copies/mL. The outcome was the time at risk of transmitting HIV divided by the observation time. Poisson’s crude 95% confidence intervals (CIs) were calculated.

The presence of CYN was confirmed in 16 samples. The homology searches revealed that amplified sequences of four water samples, which were selected from among all the samples, displayed a strong 99% homology to cyrJ gene of Aphanizomenon sp. 10E6. The culture of C. raciborskii did not contain the cyrJ gene nor the CYN. The specificity of C. raciborskii

was confirmed by application of a fragment of the rpoC1. These first genetic analyses have shown that Aphanizomenon seems to be the main cyanobacterial genus responsible for the production of CYN in the Polish lakes. The lack of toxigenicity of the isolated C. raciborskii suggests that it is possible that this invasive species does not demonstrate toxigenic activity in Polish LY2157299 clinical trial water bodies. Climate change increases water temperatures and nutrient concentration and hence the intensity of eutrophication. In consequence, global warming causes massive cyanobacteria bloom in many water bodies

(Delpla et al., 2009; Nõges et al., 2011). Ultimately, cyanobacterial blooms and their toxins pose a serious threat to public health through water supply systems, recreation or agriculture, and to the natural environment. The problem of cyanobacteria responsible for the production of microcystins (MCs) belonging to the cyanobacterial hepatotoxins is common. In Poland, regular blooms with domination of microcystin-producing cyanobacteria Planktothrix agardhii or Microcystis aeruginosa find protocol and MCs concentration reaching 212.7 μg L−1 have been documented well (Pawlik-Skowrońska et al., 2008; Mankiewicz-Boczek et al., 2006; Mazur-Marzec et al., 2010). Recently, the occurrence of other cyanotoxin (representing the group of cytotoxins), cylindrospermopsin (CYN), with maximum 1.8 μg L−1, has been reported in the Western Poland (Kokociński et al., 2009). CYN is a stable alkaloid, which is able to inhibit synthesis of proteins. Liver is the main target of the CYN activity; however, other organs, such as kidneys, lungs, thymus, spleen, adrenal glands, intestinal tract, Nabilone immune system and heart, might

also be affected (Falconer, 1999; Carmichael, 2001; van Apeldoorn et al., 2007; Žegura et al., 2011). Moreover, CYN is genotoxic and probably more hazardous to human and animal health than MCs (Žegura et al., 2011). Therefore, it seems to be important not only to estimate the concentration of CYN in the water but also to determine the source of CYN to identify early warning signals and better prevention against the CYN-producing cyanobacteria. In 1992, the strain of Cylindrospermopsis raciborskii from Australia was characterized as potent producer of CYN (Ohtani et al., 1992). So far the CYN-producing C. raciborskii strains have been isolated from Australian and Asian water bodies (Carmichael, 2001; Schembri et al., 2001; Fergusson & Saint, 2003; Mihali et al., 2008; Stüken & Jakobsen, 2010).

Among participants without virological failure ≥6 months after the start of cART, CD4 cell counts continued to increase up to 8 years, with little evidence that differences between baseline CD4 cell count groups diminished

over time. Virological failure ≥6 months after the start of cART was associated with lower subsequent CD4 cell counts, with greater CD4 cell count reduction for more recent virological failure and higher viral load. Post-cART CD4 cell counts are strongly related to pre-cART CD4 cell counts. CD4 cell count recovery is greatest in individuals who can avoid viral loads >1000 copies/mL while on cART. The benefits of combination antiretroviral therapy (cART) are well documented [1,2]. Soon after initiation, most antiretroviral-naïve individuals experience a rapid reduction Ixazomib in HIV viral load accompanied by increases in CD4 cell count and a reduced risk of new AIDS-related events and death. However, there is concern that individuals who do not start cART until their CD4 count has fallen to <200 cells/μL, either by choice or because they are diagnosed late, may experience poorer immunological responses on cART [3,4]. Individuals starting with CD4 counts <200 cells/μL

are less likely to attain a FDA approved Drug Library solubility dmso high (e.g. >350 cells/μL) CD4 count after starting cART, compared with those starting at higher CD4 counts, despite viral load suppression [5–7]. Other studies have reported that rates of CD4 cell count increase do not differ substantially among those starting

cART with different CD4 cell counts [8,9], suggesting that differences in post-cART CD4 cell count may largely be explained by differences in CD4 cell count at initiation rather than by an inability of the immune system to respond. It is unclear whether most individuals who start with CD4 counts <200 cells/μL and achieve sustained virological suppression can attain relatively normal CD4 counts if treated for sufficiently long. In antiretroviral-naïve individuals, virological selleck compound failure largely occurs following periods of incomplete adherence to treatment, although inadequate drug levels as a result of drug–drug interactions and pre-existing (transmitted) resistance also play a role [10,11]. Incomplete adherence in individuals who are still taking some antiretroviral treatment may lead to emergence of resistant HIV strains that compromise the success of cART. Complete discontinuation of cART (‘treatment interruption’) is associated with a higher risk of subsequent viral failure, poorer CD4 responses and a higher risk of clinical progression [12–14]. While several studies have assessed the impact of episodes of virological failure on immunological responses [6,8,9,15–18], results are conflicting. No study has, to our knowledge, quantified the effects of low-level compared with higher-level viraemia and the time since virological failure on long-term trends in CD4 cell counts.

Therefore, we isolated and characterized LAB strains inhabiting vegetative forage crops, taking particular interest in the development of novel Omipalisib molecular weight inoculants contributing to good fermentation quality of paddy rice silage. Finally, we investigated differences in the fermentation quality of paddy rice silage inoculated with different conspecific strains, as well as the possibility that the isolates could aid efficient fermentation of the silage. The source of isolation was described in our previous studies (Kobayashi et al., 2010; Tohno et al., 2012a). The isolation process is

described below. Grass silage (mixed pasture of timothy grass and orchardgrass), which was stored in a round bale for 300 days, was transferred into sterile homogenization bags, suspended 1 : 10 (w/v) in sterilized distilled water, and homogenized for 1 min in a Promedia Selleckchem IWR-1 SH-II M homogenizer (ELMEX, Tokyo, Japan). Serial dilutions were used for isolation of LAB using Lactobacilli de Man Rogosa Sharpe (MRS) agar (Difco, Detroit, MI) at 30 °C for 48 h under anaerobic conditions in a TE-HER Hard Anaerobox model ANX-1 (Hirosawa

Ltd, Tokyo, Japan). Isolation and purification were as follows: colonies on MRS agar medium were picked and streaked to single colonies twice on MRS agar. The pure cultures were grown on MRS agar at 30 °C for 24 h, picked and transferred to nutrient broth (Difco) with 10% glycerol, and stored as stock cultures at −80 °C. The four isolated strains used were designated TO1000, TO1001, TO1002, and TO1003. These strains were deposited in the National Institute of Technology and Evaluation Biological Resource Center (Kisarazu, Chiba, Japan). Molecular phylogeny analysis was conducted, and a phylogenetic tree was constructed based on about 1500 bases of 16S ribosomal RNA (rRNA) gene sequence as previously described (Tohno et al., 2012b). A recA multiplex PCR assay was performed to distinguish closely related species Cell press and subspecies of the L. plantarum group according to our previous report (Tohno et al., 2012b). PCR amplification of known plantaricin genes was conducted as described

elsewhere (Omar et al., 2006). The primers used are listed in Supporting Information, Table S1. Paddy rice (Oryza sativa L. subsp. japonica) at the fully ripe stage was obtained from a local field at Kumagaya, Saitama, Japan, on October 25, 2010, by cutting using grass shears. In a small-scale fermentation system (Cai et al., 1997), approximately 100-g portions of the materials, chopped into about 20-mm lengths, were packed into 180 × 260 cm Hiryu KN-type plastic film bags (Asahikasei, Tokyo, Japan) with or without various bacterial inoculants (105 colony-forming units (CFU) g−1 fresh matter), and the bags were sealed with a BH 950 vacuum sealer (Panasonic, Osaka, Japan). Small-scale silage samples in a room at ambient temperature were collected at days 30 and 60 of the ensiling process.

Anti-HBs antibody concentration ≥10 mIU/mL was considered seroprotective. Response to the additional dose of hepatitis A-containing vaccine was

defined as anti-HAV antibody concentration ≥15 mIU/mL in seronegative subjects, ≥4-fold increase in anti-HAV antibody concentration in subjects with pre-vaccination anti-HAV antibody concentrations <100 mIU/mL or check details ≥2-fold increase in anti-HAV antibody concentration in subjects with pre-vaccination anti-HAV antibody concentrations ≥100 mIU/mL. Response to the additional dose of hepatitis B-containing vaccine was defined as an anti-HBs antibody concentration ≥10 mIU/mL in seronegative subjects or a ≥4-fold increase in anti-HBs antibody concentration in seropositive subjects. The primary population for analysis was the according- to-protocol (ATP) cohort. Seroprotection/seropositivity rates, geometric mean concentration (GMC) of anti-HBs and anti-HAV antibodies, and vaccine response rates were calculated with 95% confidence intervals (95% CI). Two-sided standardized asymptotic 95% CI and Fisher exact p-values were calculated for the difference in seroprotection and response rates between groups (HAB group minus either the ENG + HAV or HBVX + VAQ group). Of the 596 subjects enrolled in the primary vaccination study (199 in the HAB group, 200 in the ENG + HAV group, and 197 in the HBVX + VAQ group),

506 returned at year 4 and received an additional dose of the same vaccine(s) used for priming (172, 170, and 164 in the three groups, respectively). Demographic characteristics of the Palbociclib ATP immunogenicity cohort at year 4 were similar between groups and were consistent with baseline characteristics in the primary Oxymatrine vaccination study. Mean (SD) age was 59.0 (9.38) years, 68.5% of subjects were overweight, 92.4% were taking concomitant medication, and 78.7% had a current medical condition.

Following primary vaccination (month 7), >97% of subjects were seropositive for anti-HAV antibodies. At year 4, the proportion of subjects remaining seropositive for anti-HAV antibodies was 97.3% in the HAB group, 93.9% in the ENG + HAV group, and 96.0% in the HBVX + VAQ group. Anti-HAV antibody GMCs were 212.9, 165.7, and 277.4 mIU/mL in the three groups, respectively, at this time. Anti-HBs seropositivity rates were 92.8% in the HAB group, 83.5% in the ENG + HAV group, and 77.8% in the HBVX + VAQ group at month 7 and 76.9, 61.9, and 51.6% in the three groups, respectively, at year 4. As shown in Figure 1A, respective percentages of subjects with antibody concentrations ≥10 mIU/mL were 91.7, 79.7, and 71.0% at month 7 and 57.1, 40.1, and 26.6% at year 4 (p≤ 0.005 for the HAB group vs the ENG + HAV group and p < 0.0001 for the HAB group vs the HBVX + VAQ group at both time-points).

0004). Comparison of mean healing time in the pimecrolimus versus placebo group, demonstrated a significant acceleration

both in intention-to-treat analysis (10.7 vs. 20.7 days, F = 17.466, P < 0.0001) and treatment-completed analysis (8.3 vs. 20.7 days, F = 29.289, P < 0.0001). Conclusion:  Pimecrolimus is safe and efficient in the treatment of BD genital ulcers, by accelerating the healing process. "
“Systemic lupus erythematosus (SLE) is an autoimmune disease in which organs undergo damage. Hypoparathyroidism this website is a rare disease, which presents in two forms: hereditary and acquired. Cases of hypoparathyroidism and SLE rarely co-exist. Only six cases have been reported; five of them first presented with lupus and then hypoparathyroidism or simultaneously. We present here developing lupus disease in a woman who had idiopathic hypoparathyroidism. selleck screening library According to increasing data about the autoimmune origin of idiopathic hypoparathyroidism, these case reports suggest that there may be an autoimmune process linking these diseases. “
“Systemic lupus erythematosus (SLE) is a chronic autoimmune disease with unknown etiology. Genetic and environmental factors play important roles in the pathogenesis of SLE. The primary objective of this study was to investigate the possible association of eNOS gene intron 4b/a, Glu298Asp and T-786C polymorphisms with SLE in southeast Iran populations. This was a case-control study comparing eNOS polymorphisms in 106 SLE patients

and 196 age- and sex-matched healthy controls. The 4b/a, Glu298Asp and T-786C polymorphisms were analyzed using polymerase chain reaction and restriction fragment length polymorphism.

Our findings indicated that the 4b/a polymorphism was associated with SLE, and the risk of SLE was 3.5- and 1.75-fold higher in patients with aa and ba genotypes than in patients with bb genotype. No association was observed between Glu298Asp and T-786C polymorphisms and SLE. There were no differences in eNOS gene polymorphisms between the Balouch and Fars population. Statistically significant differences were observed in genotypes and allele frequencies of 4b/a polymorphism between patients with SLE and healthy controls in southeast Iran. “
“Behcet’s disease Suplatast tosilate (BD) is a rare disease mostly seen along the Silk Road. The prevalence has been reported as 0.12 (USA) to 370 (in a single village, northern Turkey) for 100 000 inhabitants.[1] During the past four decades, due to immigrations, the prevalence in Europe and North America has gradually increased.[2] It is now 4.2 in Germany, 7.2 in France and 8.6 in the US. Behcet’s disease is classified among the vasculitides and the pathophysiology is thought to be autoimmune, although some propose it as an autoinflammatory disease. Human leukocyte antigen (HLA)-B51 is recognized as a genetic factor. Hyperfunction of neutrophils, reactive oxygen species production, T-cell abnormalities, heat shock proteins (microbial and viral) are all involved in the ethiopathogenesis.

Control RT-PCRs, excluding reverse transcriptase, were performed to check for DNA contamination of the RNA preparations. The JI operon was deleted from the chromosome of strain BEN2908 using the red recombination procedure (Datsenko & Wanner, 2000). Briefly,

the JI operon was replaced with a kanamycin resistance cassette that was generated by PCR using primers PD0325901 with extensions that are homologous to regions adjacent to the sequences to be inactivated. The kanamycin resistance cassette was obtained by PCR amplification from plasmid pKD4, using the primers RI-yicJ-P1 (CAAGAATCATAAATTAATAACCAGATATCGGAATATTCG CTCTCGCAGGGGTGTAGGCTGGAGCTGCTTCG) and RI-yicI-a (ATTTACCGGATA CGACACAAAACCATTCGTATCCGGCATTCTTCAATAGAAGAGCGCTTTTGAAGCTGGG). The 5′ extensions (underlined

in the primer sequences) of the RI-yicJ-P1 and RI-yicI-a primers are homologous to 50 nucleotides immediately upstream of the start codon of yicJ and to 50 nucleotides immediately downstream of the stop codon of yicI, respectively. The deletion procedure thus conserved the complete intergenic regions between selC and yicJ and between yicI and the frz operon. The replacement of the JI operon was confirmed by PCR using the primer pairs C4488/skana (acaatagtcgtatattcccttcgagg/caacctgccatcacgagatt) Selleck PARP inhibitor and askana1/RI-YicJ-selC (cagatagcccagtagctgacatt/ggcgcattatagctacttccttga), which allows the detection of left and the right junctions between the bacterial chromosome and the kanamycin resistance cassette, respectively. PCR with the primer pairs C4488/RI-YicJ-selC allowed the amplification of a 1991-bp DNA fragment, confirming the integration of the complete kanamycin resistance cassette. Southern blots of EcoRV- or SspI-digested DNA of the mutants with a probe that was generated by PCR amplification

of the kanamycin resistance gene (primers Cat51, gtgtaggctggagctgcttc and Askana2, ccgaagcccaacctttcata) http://www.selleck.co.jp/products/Abiraterone.html revealed a 3956- and a 1502-bp DNA fragment, respectively. This indicated that the kanamycin cassette was also not illegitimately inserted into another part of the genome. The sequence of the E. coli strain BEN2908 JI region has been deposited in the EMBL database under accession numbers FR667153, FM253092, and AY857617. To determine whether common DNA motifs putatively involved in the regulation of the yicJI and the frz operons are present in the yicJI and frz intergenic regions, we first completed the sequence of the yicJI region of the ExPEC strain BEN2908. As in other sequenced E. coli genomes, the BEN2908 yicJ gene is separated from the yicI gene by only nine nucleotides. Correctly spaced σ70−10 and σ70−35 putative promoter sequences and a putative ribosome-binding site were identified upstream of the start codon of the yicJ gene (Fig. 2a).

26 Carlsten showed a protective effect of 250 mg bid but not of 125 mg bid in La Paz (3,630 m) in travelers who flew in from Miami (sea level).27 It is possible that a low dose of acetazolamide works better in partially acclimatized travelers at very high altitude than in travelers who just arrived at high altitude. Although most experts today advise a preventive dose of 125 mg twice daily, a review on efficacy of pharmacological prevention of AMS (which is not generally accepted) concluded that a daily dose of 500 mg acetazolamide was not effective while 750 mg was; and in his 2008

review, Wright concluded that 500 mg/d should be used preventively.28,29 The fact that we found no association between acetazolamide treatment and the duration of AMS may be because of the low average dose of 375 mg/d or 5 mg/kg/d that was taken, as the only (small) randomized controlled trial on efficacy of Selleckchem A 769662 acetazolamide treatment used 500 mg/d, which corresponds to 7 mg/kg/d for a 70 kg person.30 It could also be explained by a difference in severity of complaints in both groups, as those who did not take acetazolamide often reported that they refrained from the treatment because the symptoms were mild. This indicates a serious bias and it implies that no conclusion regarding the effect of acetazolamide treatment on the duration of symptoms can be made. This survey has several possible weaknesses. It relies on the accuracy of

self-reported data Mitomycin C collected a few weeks after return and the assumption that the responders are representative of the target population. Sclareol The response rate was higher than in several other surveys on AMS4 and of the returned questionnaires, very few had missing data. We did not phone non-responders, but several of them informed us that they ended up not climbing above 2,000 m. In this study, we did not differentiate between mild and serious complaints, which implies that we cannot conclude anything on the effect of acetazolamide treatment on the duration of AMS complaints. Of course, our study is not randomized

double-blind placebo controlled, but even in the subgroup of travelers with previous AMS we found no relation between acetazolamide prevention and AMS incidence while there was no difference in risk factors like sex, age, maximum altitude, and nights of acclimatization in those who took prevention and those who did not. As most other predictors of AMS are fixed when clients come to our travel clinic, we should stress the importance of at least 2 days of acclimatization between 1,500 and 2,500 m. As Alan J. Magill explained in the Expert Opinion Series of the International Society of Travel Medicine, even those who fly to an airport at high altitude often can descend after arrival to spend a few nights at a lower altitude.31 We should also stress the importance of a flexible travel itinerary in order to be able to change it when problems arise.

Polyclonal antiserum against the M. oxyfera and NirS enzyme was raised by injecting rabbits with two synthetic peptides: peptide 1 (amino acid position 139–153: PPDKRPTKPEHNRDW) and peptide

2 (amino acid position 520–534: EKARIDDPRIITPTG). Prior to the immunization, an extra amino-terminal cysteine was added to the peptide sequences for the conjugation to the Keyhole limpet haemocyanin (Eurogentec, Belgium). For the M. oxyfera pMMO enzyme, two polyclonal antisera buy Tyrosine Kinase Inhibitor Library targeting α-subunit (pMmoB) were raised. α-pMmoB1 was raised by injection of rabbits with two synthetic peptides: peptide 1 (amino acid position 257–271: QTGRMDTPELKPTTE) and peptide 2 (amino acid position 324–337: DPALFPDSRLKIKVE). Prior to the immunization, an extra amino-terminal SB203580 purchase cysteine was added to the peptide sequences for the conjugation to the Keyhole limpet haemocyanin (Eurogentec). α-pMmoB2 was generated from a heterologously expressed and purified fragment of pmoB in Escherichia coli as described previously (Harhangi et al., 2002), with the following modifications. Two primers were designed on the pmoB sequence; a forward primer on nucleotide position 790 (CCCGAACTGAAGCCCACGACAGAG) and a reverse primer on nucleotide position 1188 (GCCGCCGACCTCAACAATTTGTCTG). A stop codon

(TAA) was included in the reverse primer so as to express only an N-terminal His-tag. For directional cloning, restriction sites EcoRI and NotI were included in the forward primer and XhoI in the reverse primer. An additional nucleotide (T) was added between EcoRI and NotI so as to bring the sequence in frame. pET-30a(+) (Novagen, Germany) was used as the expression vector. Rosetta cells (Novagen) were used as the expression host. The heterologously expressed protein fragment (amino acid position 264–396) was purified using the HIS-Select® HF nickel affinity gel column (Sigma, The Netherlands) under denaturing conditions using the protocol dipyridamole provided by the manufacturer. The identity of the expressed protein fragment was verified by MALDI-TOF MS peptide mass fingerprinting of a tryptic digest of the purified

protein fragment (Harhangi et al., 2002). For each antiserum, two rabbits were immunized using a 3-month immunization protocol. The antisera from both rabbits were pooled and affinity-purified (Eurogentec). The affinity-purified antisera (α-NirS, α-pMmoB1 and α-pMmoB2) were used as the primary antisera in immunoblot analysis and immunogold localization as described later. Approximately 2 g of cells (wet weight) was taken from the M. oxyfera enrichment culture. The cells were washed three times with 20 mM phosphate buffer pH 8.0 and resuspended in a medium containing 20 mM sodium phosphate and 50 mM sodium pyrophosphate pH 8.0. Cells were broken by sonication. Cell debris was removed by centrifugation (6000 g, 15 min, 4 °C), and the supernatant was collected as whole-cell extract.

salmonis. In this context, and considering that key virulence genes that distinguish pathogenic bacteria are generally carried on transmissible CT99021 cell line genetic elements (Hacker et al., 1997), it would not be surprising if the genomic complexity of P. salmonis included other types of MGEs, a feasible alternative that our laboratory is currently investigating. In summary, this is the first description of a putatively functional IS in the genome of P. salmonis. Our results reveal that ISPsa2 shares high similarity to previously described ISs – specifically to IS240

elements, which are members of the IS6 family. As shown in Table 2, our new IS shares the key features that distinguish the IS6 family elements, such as length, IR size and END sequence. The putative transposase encoded within ISPsa2 (Tnp-Psa) carries conserved motifs that are also found in other transposases (Fig. 2). The presence of a putative promoter region in frame with Tnp-Psa in ISPsa2 strongly suggests a regulated

self-expression for the IS and may represent a preliminary indication of the high genomic plasticity of this fish bacterial pathogen. Additionally, the ISPsa2 sequence appears to be in other strains of the pathogen, or at least in three isolates obtained from epizootics in 2010 (Fig. 3). This work was CP-690550 supplier supported by Innova Corfo grant 05CT6IPD-22 to S.M., C.C. and V.H. and by Conicyt (Beca Nacional de Doctorado) to F.G. “
“We report the effect of glutathione and the role of reactive oxygen species (ROS), assayed by a nitro blue tetrazolium reaction, on the antibacterial action of ciprofloxacin,

gentamicin and chloramphenicol in Staphylococcus aureus 22 resistant to ciprofloxacin SB-3CT and gentamicin, and in S. aureus ATCC 29213 sensitive to the above three antibiotics. The association of glutathione with ciprofloxacin or gentamicin significantly reduced the value of the minimum inhibitory concentration (MIC) in resistant S. aureus 22, measured using the macrodilution method, with a concomitant increase of intracellular ROS and a decrease of extracellular ROS. However, glutathione did not induce modifications in MIC or ROS generated by chloramphenicol. Furthermore, in the sensitive S. aureus ATCC 29213, the association of glutathione with ciprofloxacin, gentamicin or chloramphenicol did not induce any significant variations of MIC or ROS. There was a correlation between the stimulus of intracellular ROS and the decrease of MIC caused by exogenous glutathione. According to the results obtained, it is possible to modify the sensitivity of resistant strains of S. aureus by the addition of exogenous glutathione.